Home
October 2008 November 2008 December 2008
Su Mo Tu We Th Fr Sa
Week 44 1
Week 45 2 3 4 5 6 7 8
Week 46 9 10 11 12 13 14 15
Week 47 16 17 18 19 20 21 22
Week 48 23 24 25 26 27 28 29
Week 49 30

European Urology - Acetylcholine and Molecular Components of its Synthesis and Release Machinery in the Urothelium Show Comments PDF Print E-mail
  
Monday, 02 April 2007
Volume 51, Issue 4, Pages 1042-1053 (April 2007)

1. Introduction

Synthesis and release of acteylcholine (ACh) is not restricted to specialized subsets of neurons but also occurs in a broad variety of non-neuronal cells, in particular in surface epithelia [1], [2]. Recent studies suggest that this may apply for the bladder urothelium as well. Urothelial ACh has been proposed to be released into the bladder lumen to address nicotinic receptors on the luminal membrane of umbrella cells or to be released basally to act upon the detrusor and nerve fibres [3], [4], [5], [6]. So far, however, there is only indirect experimental evidence for urothelial ACh. Yoshida et al. [6], [7] measured ACh release from isolated human bladder strips and demonstrated a reduced release in preparations in which the epithelium had been removed. These findings are compatible with a urothelial release of ACh, but also with urothelial release of another factor that might trigger ACh release from deeper structures. In addition, immunolabelling of the urothelium with an antiserum directed against the ACh-synthesizing enzyme choline acetyltransferase (ChAT) has been reported [6], [7], although these data still await validation by preabsorption experiments or other independent methods, such as Western blotting, determination of ChAT activity, or reverse transcriptase–polymerase chain reaction (RT-PCR).

On this background, we set out to determine the molecular components of a putative cholinergic system in the urothelium in more detail. First, ACh was detected in the urothelial cell layer by a high-performance liquid chromatography-electrochemical (HPLC-EC) method. Next, we employed RT-PCR and immunohistochemistry to investigate urothelial expression of (1) ChAT, the classical Ach-synthesizing enzyme in the nervous system and several non-neuronal cells; (2) carnitine acetyltransferase (CarAT), which is responsible for ACh synthesis in muscle cells [8]; (3) the vesicular ACh transporter (VAChT), which shuffles ACh from the cytoplasm into synaptic vesicle in cholinergic nerve terminals [9]; and (4) polyspecific organic cation transporters (OCTs; isoforms 1–3), which are able to translocate ACh directly across the plasma membrane [10]. In view of their polyspecific properties [11], we tested whether a commonly used anticholinergic drug, trospium chloride, interferes with ACh transport by OCTs. The study was performed on human and murine urothelium in parallel to evaluate whether the mouse may serve as a suitable model for experimental approaches addressing this system in the future.

2. Materials and methods

2.1. ACh assay

FVB mice were killed by inhalation of an overdose of isoflurane (Abbott, Wiesbaden, Germany). The bladder was carefully dissected, opened, and fixed in a Petri dish with the luminal surface facing upwards. A cotton-tipped applicator (Q-tip) was gently rubbed along the luminal surface and thereafter placed in 1ml 15% formic acid in acetone (v/v). Two samples were taken from the luminal surface (about 2cm2) of human urinary bladders obtained from surgery. After standing on ice (30min), specimens (material swiped off by the Q-tip) were frozen in liquid nitrogen. The bladder was then fixed in buffered 4% paraformaldehyde and processed as described for immunohistochemistry; then serial cryosections were stained with hematoxylin-eosin and evaluated by light microscopy. Only those specimens were included in the further analysis in which the basal lamina was not disrupted.

ACh was measured by cationic exchange HPLC combined with bioreactors and electrochemical detection with a detection limit of 10fmol ACh per injection (20μl) as described in detail elsewhere [12].

2.2. Reverse transcriptase–polymerase chain reaction

Murine samples were obtained by scraping off the urothelium as described above, but specimen holders were then placed in lysis buffer (RLT-buffer; Qiagen, Hilden, Germany) instead of formic acid/acetone. Further sample processing was as described in detail earlier [10]. Primer sequences are provided in Table 1.

Table 1.

Primers used for RT-PCR

Primer* Sequence Product length (bp) Species Accession
VAChT 571 Mouse, rat NM_021712, NM 031663
for GTATCCCGAGGAGCCTGAG
rev CTGTGTCCACTAACGCGATG
OCT1 186 Mouse NM_009202
for GTAAGCTCTGCCTCCTGGTG
rev GCTGTCGTTCTCCTGTAGCC
OCT2 169 Mouse NM_013667
for TACCGGAGTCTCCAAGATGG
rev GACCAAGTCCAGGAACGAAG
OCT3 160 Mouse NM_011395
for CAGATATGGCAGGCTCATCA
rev TCACGATCACGAAGCAAGTC
ChAT1 400 Mouse NM_009891
for GAGCAGTATCATGCCTGAGC
rev CTGCAGGGACTTGTCATACC
ChAT2 183 Mouse NM_009891
for CCTGCCAGTCAACTCTAGCC
rev TCAGGGCAGCCTCTCTGTAT
ChAT3 178 Mouse NM_009891
for GCCCACCTATGAGAGTGCAT
rev GTACTCAGTTTGGGCCTGGA
ChAT4 1947 Mouse NM_009891
for TGCCTATCCTGGAAAAGGTC
rev GGCTGCCTCGAACTACAGAG
M-ChAT1 276 Mouse D12487
for AGAGAGGTGTGGCTGGTTTG
rev GGACCTTTTCCAGGATAGGC
M-ChAT2 360 Mouse [29]
for AGAGAGGTGTGGCTGGTTGTCTTG
rev CCAGTGCCCCCACTGCAGCAAACCCTGGCC
M-ChAT3 300 Mouse [29]
for TTCGTCGGAGGCTCTGCTACAGAACC
rev CCAGTGCCCCCACTGCAGCAAACCCTGGCC
N-ChAT1 346 Mouse D12488
for CCAGGCTCTATCATCTGAGG
rev GGACCTTTTCCAGGATAGGC
N-ChAT2 78 Mouse [29]
for GGATCCAGGCTCTATCATCTGAGG
rev CCAGTGCCCCCACTGCAGCAAACCCTGGCC
R-ChAT1 273 Mouse D12490
for CTGATCTGTTCAGCCTGTCG
rev GGACCTTTTCCAGGATAGGC
R-ChAT2 184 Mouse D12490
for CTGCAAATCAGGACGCTCAG
rev GGACCTTTTCCAGGATAGGC
R-ChAT3 300 Mouse [29]
for CATAGGCTGATCTGTTCAGCCTGTC
rev CCAGTGCCCCCACTGCAGCAAACCCTGGCC
VAChT 157 Human U10554
for TACCCTACGGAGAGCGAAGA
rev CTGTAGAGGCGAACATGACG
ChAT1 151 Human/mouse NM-020549
for ATCGCTGGTACGACAAGTCC
rev ATCAGCTTCCTGCTGCTCTG
ChAT2 215 Human NM-020549
for GCAGGAGAAGACAGCCAACT
rev AGTCAGTGGGAATGGAGTGG
hOCT1 198 Human NM_153187
for GACGCCGAGAACCTTGGG
rev GGGTAGGCAAGTATGAGG
hOCT2 302 Human NM_003058
for TCGTCCATCGTCACCGAGT
rev TATCTCCGCCCAACAAATTC
hOCT3 216 Human NM_021977
for GGAGTTTCGCTCTGTTCAGG
rev GGAATGTGGACTGCCAAGTT
GAPDH 299 Mouse/human AF106860
for CGTCTTCACCACCATGGAGA
rev CGGCCATCACGCCACAGCTT

bp: base pair; ChAT: choline acetyltransferase; for: forward; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; hOCT; human organic cation transporter; OCT: organic cation transporter; rev: reverse; VAChT: vesicular acetylcholine transporter.

* M-, N- and R-ChAT primers are designed to amplify products from the noncoding M-, N- and R-exon, respectively, of the ChAT gene.

All other primers are designed to amplify products within the coding regions.

NS20Y cells—a cholinergic murine forebrain neuroblastoma cell line (German Collection of Microorganisms and Cell Culture, Braunschweig, Germany)—were used as a positive control for expression of components of the murine cholinergic system.

Human bladder mucosal biopsies were obtained from six female patients aged between 57 and 76 yr (mean: 67). All patients underwent endoscopic surgery primarily to remove bladder cancer or to examine the bladder wall by biopsies for carcinoma in situ or interstitial cystitis. Four additional mucosal biopsies were taken out of the trigonum (four patients) or the bottom (two patients) of the bladder with the use of endoscopic forceps. This procedure was approved by the local ethics committee, and informed patients gave signed consent. Processing of these specimens was identical to that of murine specimens, except that human specific primers were used Table 1.

Caco cells—a human colonic epithelial cell line (German Collection of Microorganisms and Cell Culture)—served as a positive control for human epithelial ChAT expression. Additional complementary DNAs generated from airways during a previous study [10] were also used as positive controls.

2.3. Immunohistochemistry

Mice were killed by isoflurane inhalation; then the bladder was rapidly dissected, embedded in optimal-cutting-temperature compound, and shock-frozen in melting isopentane. For ChAT immunohistochemistry, bladders from six additional mice were filled via a cannula with buffered 4% paraformaldehyde and immersed in the same fixative for 2h, before being rinsed several times in 0.1mol/l phosphate buffer (PB), immersed overnight in the same buffer supplemented with 18% sucrose for cryoprotection, and shock-frozen. From each patient from whom a mucosal biopsy had been obtained for RT-PCR analysis, a second biopsy was shock-frozen as described to be processed for immunohistochemistry. Cryosections (10μm) were fixed either in acetone for 10min at −20°C or in Zamboni fixative (2% paraformaldehyde, 15% saturated picric acid in 0.1mol/l PB) for 20min and then processed for routine indirect immunofluorescence as described elsewhere [10]. Antibodies are listed in Table 2.

The sections were evaluated by epifluorescence microscopy (Axioplan 2 imaging; Zeiss, Jena, Germany) or with a confocal laser-scanning microscope (TCS SP2; Leica, Mannheim, Germany).

Table 2.

Characteristics of antisera

Antigen Host species Dilution Fixative Source/reference
Primary antibodies for use in murine tissues
ChAT, synthetic peptide, aa 282–295 of rat “common ChAT” sequence Rabbit 1:8000 PFA [23]
VAChT Goat 1:800 Acetone, PFA Biotrend, Cologne, Germany
OCT1, synthetic 21 aa peptide, near C-terminus Rabbit 1:20 Acetone Alpha Diagnostics, San Antonio, USA
OCT2, synthetic 21 aa peptide Rabbit 1:400 Acetone Alpha Diagnostics
OCT3, synthetic 18 aa peptide Rabbit 1:400 Acetone Alpha Diagnostics
Primary antibodies for use in human tissues
ChAT; synthetic peptide, aa 282–295 of rat “common ChAT” sequence Rabbit 1:8000 Zamboni [23]
VAChT Goat 1:500 Zamboni Biotrend, Cologne, Germany
OCT1, synthetic 21 aa peptide, near C-terminus Rabbit 1:20 Acetone Alpha Diagnostics
OCT2, synthetic peptide, aa 533–547 of human sequence Rabbit 1:200 Acetone [10], [30]
OCT3, synthetic peptide, aa 297–313 of human sequence Rabbit 1:500 Acetone [10]
Antigen Host species Dilution Conjugate Source
Secondary antibodies
Rabbit-IgG Donkey 1:2000 Cy3 Chemicon, Hofheim, Germany
Goat-IgG Mouse 1:400 FITC Sigma-Aldrich, Taufkirchen, Germany

ChAT: choline acetyltransferase; IgG: immunoglobulin G; OCT: organic cation transporter; PFA: paraformaldehyde; VAChT: vesicular acetylcholine transporter.

For all primary antisera, the corresponding antigen for preabsorption was available from the same source as the antiserum. In addition, CarAT isolated from pigeon breast muscle was obtained from Sigma-Aldrich, Taufkirchen, Germany, and used for preabsorption experiments with the ChAT antiserum.

The specificity of the primary antibodies was validated by (1) omission of the primary antibody, (2) preabsorption with their corresponding antigen (Table 2) at a concentration of 40μg/ml for 1h at room temperature before use in immunofluorescence, and (3) evaluation of immunofluorescence in genetically OCT-deficient mice (OCT1/2 double-knockout mice) by using tissues collected during a previous study [10].

2.4. Expression of OCTs in epithelial cells and transport measurements

Human OCT1, OCT2, and OCT3 were stably expressed in Chinese hamster ovary (CHO) cells by methods described in detail earlier [10], [13]. For transport measurements, confluent cells were washed with phosphate-buffered saline (PBS), suspended by shaking, collected by 10-min centrifugation at 1000×g, and suspended at 37°C in PBS. The cells were incubated for 1s in PBS containing the prototypic substrate 0.2μmol/l [3H]1-methyl-4-phenylpyridinium ([3H]MPP), without inhibitor or in the presence of increasing concentrations of trospium chloride. Uptake was stopped by addition of ice-cold PBS containing 100μmol/l quinine (stop solution), and the cells were washed three times with ice-cold stop solution. To measure uptake at 0-s incubation, ice-cold stop solution was added to the cells first, and radioactive substrates were added thereafter. Uptake rates were calculated from quadruplicate measurements after 0-s incubation and 1-s incubation. Uptake rates of [3H]MPP in the presence of different concentrations of trospium chloride were calculated from measurements after 0s and 1s incubation. For each transporter, three or four independent experiments were performed in which four measurements were conducted for each concentration of trospium chloride. The Hill equation for multisite inhibition was fitted to individual (not shown) or to normalized and combined experiments (Fig. 8A–D). Mean values±SD were calculated from the mean inhibitory concentration (IC50) values of the individual experiments (Fig. 8D). The significance of differences between the mean IC50 values was estimated by one–way analysis of variance followed by Tukey comparison.

3. Results

3.1. ACh and its synthesizing enzymes

ACh concentration in the murine urothelium amounted to 0.22±0.03nmol/g wet weight (mean±SEM; n=6). Eight and 14pmol, respectively, were measured in the two available samples of human urothelium. RT-PCR failed to detect ChAT messenger RNA (mRNA) both in murine (13 different primer sets tested) (Fig. 1A) and human (2 different primer sets tested) urothelium (Fig. 2A) despite positive results in human Caco cells (Fig. 2A), murine spinal cord (Fig. 1A), and murine tracheal epithelium (not shown). CarAT mRNA, however, was readily detectable (Fig. 1A). In immunohistochemistry, the ChAT antiserum distinctly labelled all cell layers in both murine and human urothelium (Fig. 1, Fig. 2). This labelling could be prevented by preabsorption of the antiserum with its corresponding synthetic antigen (Fig. 1C). In view of the RT-PCR data and the known structural similarity of ChAT with CarAT, we also preincubated the ChAT antiserum with CarAT isolated from pigeon breast muscle, which also resulted in loss of urothelial labelling (Fig. 1, Fig. 2). Hence, this immunolabelling was not suited to discriminate between ChAT and CarAT in the urothelium.


Fig. 1. ChAT in murine urothelium. (A) Reverse transcriptase–polymerase chain reaction demonstrates the urothelial expression of CarAT, but not of ChAT (primer pair murine ChAT2, Table 1). Spinal cord served as positive control for efficiency of detecting ChAT messenger RNA. (B–D) ChAT immunolabelling of the urothelium (B) can be successfully preabsorbed both with synthetic ChAT antigen (C) and with CarAT protein (D). Bar=20μm. bp: base pair. CarAT: carnitine acetyltransferase; ChAT: choline acetyltransferase.


Fig. 2. ChAT in human urothelium. (A) Reverse transcriptase–polymerase chain reaction failed to detect ChAT in the urothelium despite positive signals in Caco cells. (B, C) ChAT immunolabelling of the urothelium (B) can be successfully preabsorbed with CarAT protein (C). Bar=20μm. bp: base pair; CarAT: carnitine acetyltransferase; ChAT: choline acetyltransferase; Uro/CaCo 1+2: primer pair human ChAT1; Uro/Caco 3: primer pair human ChAT2 (Table 1).

3.2. Molecular components of the ACh release machinery

VAChT, the vesicular transporter shuffling ACh from the cytosol into synaptic vesicles in cholinergic neurons, was detected neither by RT-PCR nor by immunohistochemistry in murine and human urothelium (Fig. 3, Fig. 4). Instead, numerous VAChT-immunoreactive nerve fibres were observed immediately underneath the urothelial basal membrane in the lamina propria (Fig. 3B). Among polyspecific OCTs, isoforms OCT1 and OCT3 were readily detected by RT-PCR both in murine and human urothelium (Fig. 5). Immunohistochemistry supported these data. OCT1 immunolabelling was observed throughout the epithelial layers with pronounced labelling of the intermediate and basal cells, and OCT3 immunoreactivity was nearly restricted to the basal cells (Fig. 6, Fig. 7). Specific OCT2 immunolabelling was not obtained in the urothelium (Fig. 6, Fig. 7).



Fig. 3.
VAChT in murine bladder mucosa is undetectable by reverse transcriptase–polymerase chain reaction (A; spinal cord served as positive control). GADPH-specific primers confirmed efficacy of RNA isolation and reverse transcriptase. In immunohistochemistry, VAChT is restricted to subepithelial nerve fibres (arrows in B). (C) Preabsorption control. Bar=20μm. bp: base pair; GADPH: glyceraldehyde-3-phosphate dehydrogenase; H2O: control run without template; VAChT: vesicular acetylcholine transporter.

Fig. 4. VAChT in human urothelium. Neither reverse transcriptase–polymerase chain reaction (RT-PCR) (A) nor immunohistochemistry (B) provides specific positive results. Nonspecific labelling of suburothelial structures persists after preabsorption of the antiserum (C). Human bronchial epithelium served as positive control for VAChT messenger RNA detection by RT-PCR, and GADPH-specific primers confirmed efficacy of RNA isolation and RT. Bar=20μm. bp: base pair; GADPH: glyceraldehyde-3-phosphate dehydrogenase; VAChT: vesicular acetylcholine transporter.


Fig. 5. Expression of OCT isoforms, reverse transcriptase–polymerase chain reaction. OCT1 and 3 are express