Home
February 2010 March 2010 April 2010
Su Mo Tu We Th Fr Sa
Week 9 1 2 3 4 5 6
Week 10 7 8 9 10 11 12 13
Week 11 14 15 16 17 18 19 20
Week 12 21 22 23 24 25 26 27
Week 13 28 29 30 31

European Urology - Gene Expression in Normal Urothelium Depends on Location within the Bladder: A Possible Link to Bladder Carcinogenesis Show Comments PDF Print E-mail
Wednesday, 19 July 2006
Volume 50, Issue 2, Pages 290-301 (August 2006)

1. Introduction:

Transformation of the normal bladder epithelium is accompanied by a plethora of molecular and biochemical changes [1], [2], [3]; the first of these genetic alterations may precede the diagnosis of cancer by several decades.
Early studies of the bladder have revealed that more than 70% of primary bladder tumours arise in the area around the ureteric orifice; the remaining 30% occur in other regions of the bladder [4], [5]. Embryology of the bladder is complex; even though the trigone that encompasses the ureteric orifices has developed from the mesodermal Wolffian ducts, the remainder of the bladder is of endodermal origin [6]. In the resting state, the urothelium has an extremely low mitotic index, and remains quiescent until the need arises for proliferation. Previous research has shown deficiency in the nucleotide salvage pathway enzyme thymidine kinase (TK1) in the ureteric orifice compared to the dome (most distant); this could increase susceptibility to carcinogenesis [7]. To date, however, there has been no comprehensive explanation for this phenomenon.

In this study, microarray analysis was used on paired samples from normal ureteric orifice and dome bladder mucosa samples. Differences in genes or pathways between these two anatomically distinct sites could provide important clues about the mechanism that governs carcinogenesis in the bladder and possibly in other epithelial tissues.

2. Methods

2.1. Tissue procurement

Ethical approval was granted by the University of Ulster, Northern Ireland, UK (project no. 98/3). The consenting patient group consisted of males aged 26–81 who were referred to the Belfast City Hospital Haematuria clinic. On cytoscopic examination, when no observable lesions were found, small samples of normal ureteric orifice and dome tissue were obtained by the cold cup method. Samples were stored in RNALater at 4°C until collection.

2.2. RNA extraction

RNeasy Mini-kit (Qiagen, UK) was used according to the manufacturer's instruction to isolate total RNA from tissue specimens. The integrity of the RNA was verified by agarose gel electrophoresis and quantified with spectrophotometry. Subsequently, to minimise individual variation and obtain a “biological average”, RNA extracted from the ureteric orifice and dome biopsies of the 33 male patients was pooled and concentrated to 5μg/μl in a final volume of 20μl. Of this total RNA, 1μg was retained for further analysis by RT-PCR.

2.3. Microarray hybridisation and scanning

The hybridisation to the human UniGEM 2.0 microarray was performed by Incyte Genomics (St. Louis, Missouri, USA). Briefly, for this analysis, 100μg of RNA from each pooled ureteric orifice and dome samples were transcribed into cDNA labelled with Cy3 and Cy5 fluorescence, respectively. The samples were hybridised to the array slide, which consisted of 10,176 probes. These included 96 control probes (a variety of control elements arrayed in quadruplicate, including yeast fragments added to the two-probe labelling reactions in known amounts and increasing concentrations to control for signal sensitivity). Background was subtracted based on fluorescence from the control probes, and the ratio of Cy3:Cy5 was determined. Data from the UniGEM array were initially analysed with the commercially available GEMTools™ Software package (Incyte, Palo Alto, California, USA). Results were corroborated by the data normalisation/analysis methodology described here.

2.4. Data analysis

Although only one cDNA microarray was conducted, collecting a pooled sample per bladder location from a cohort of 33 patients reduced interindividual variability and data noise. Additionally, applying normalisation of differential expression levels ensured the usability of the data. A normalisation factor was calculated as follows:

where and are both measures of hybridisation intensity for an observed ith gene. The Cy5 channel is scaled by the normalisation factor, so the normalised differential expression ratio can be denoted as:
The statistical significance threshold was set as a twofold or greater difference in expression. Subsequently we used a method that involves calculating the standard deviation of the distribution of log2-transformed differential expression measures to corroborate our fixed fold-change cut-off. This allowed us to define a more comprehensive global fold-change difference and confidence value. This is equivalent to the calculation of Z-scores. Since the mean of normalised differential expression measures () approaches zero, we can define Z-scores for each gene as , where the differentially expressed genes, at a 95% confidence level, would be those with |Zi|≥1.96.

We used the Gene Ontology Consortium (www.geneontology.org/) to gather information on function, mapping, and expression of individual genes and ESTs and to identify mechanistic patterns. Genes with multiple roles were included in more than one category.

2.5. Complementary DNA synthesis

Total RNA (1μg) was reverse transcribed by Superscript II enzyme with 0.5μg oligo (dT)18 (Invitrogen, Paisley, UK). The reaction mixture was incubated at 42°C for 2h, then incubated at 72°C for 10min. The resulting cDNA was diluted tenfold.

2.6. Semiquantitative PCR

Each gene-specific primer set (Cdc25B, PKM, and TK1) was optimized to determine the exponential phase of PCR. PCR was performed in a final volume of 50μl that contained 1μl of cDNA, 0.4μM of each primer (Table 1), 0.2mM dNTPs, 1.5mM MgCl2, 1.25U Taq, 5μl of 10× PCR buffer (Invitrogen, Paisley, UK), and the remainder molecular-grade water. To ensure the fidelity of mRNA extraction and reverse transcription, we subjected samples to PCR amplification with oligonucleotide primers specific for the constitutively expressed gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and normalized.


Table 1.  Primer sequences, annealing temperature, and amplicon size of the genes used in this study
Gene Primer sequence Anneal temp (°C) Amplicon BP
Seladin-1 SENSE: TCCAGGGTTGAATCTTGTCC 60 302
ANTISENSE: GGGATGAGTGGTTGGAGAAA
Cell division cycle 25 B (Cdc25B) SENSE: CTCATTAGTGCCCCACTGGT 60 294
ANTISENSE: GTGGTCACTGTCCAGGAGGT
Thymidine kinase 1 (TK1) SENSE: GATCTGGCACACTCCCTCTC 60 251
ANTISENSE: AGGTAGGAAGGGCTTTGAGC
Platelet-derived growth factor receptor alpha (PDGFra) SENSE: CAGACAGGGCTTTAATGGGA 60 251
ANTISENSE: TGCCTTTGCCTTTCACTTCT
Pyruvate kinase muscle PKM SENSE: AGGCTGCCATCTACCACTTG 60 254
ANTISENSE: GAAGATGCCACGGTACAGGT
Glyceraldehyde phosphate dehydrogenase (GAPDH) SENSE: TGAAGGTCGGAGTCAAAGGATTTGGT 60 1029
ANTISENSE:GCCATGTGGGCCATAAGGTCCACCAC
28s rRNA SENSE: TTGAAAATCCGGGGGAGAG 60 100
ANTISENSE: ACATTGTTCCAACATGCCAG

2.7. Real-time PCR

Real-time RT-PCR was performed on a LightCycler Thermal cycling and continuous monitoring of PCR products were performed with the Fast Start DNA Master SYBR Green I kit (Roche Diagnostics Ltd, Lewes, UK) that contained Taq-DNA polymerase, reaction buffer, dNTP mix, SYBR® Green I dye, and MgCl2. In a final volume of 20μl of master mix that contained 0.25μM of each primer (Table 1), 2μl cDNA was added. Seladin-1, PDGFra, and r28S amplification were carried out in triplicate for each sample. The cycling conditions were as follows: initial denaturation at 95°C for 15min, followed by 50 cycles at 95°C for 15s, 60°C for 30s, and 72°C for 30s. The emitted fluorescence was captured and analysed with the Lightcycler analysis software version 3.5. The crossing points (Ct), were determined by the second derivative algorithm and arithmetic baseline adjustment. Melting curve analysis enabled differentiation of the PCR products. Standard curves were constructed from tenfold serial dilutions of cDNA prepared from the Seladin-1, PDGFra, and r28S expressing T24 bladder cancer line by plotting the relation between the Ct and the logarithm of copy numbers of amplified products. Four standards (serial dilutions) and a negative control without template were included in each run.

3. Results

3.1. Genes exhibit differential expression profiles in ureteric orifice versus dome cells

A UniGEM 2.0 microarray that contained 10,176 cDNA clones was used to examine the relative gene expression between ureteric orifice and dome mRNAs that were extracted from the bladder. We used a ratio-to-intensity (R-I) plot to assess the quality of our normalised gene expression distributions by inspecting the symmetry of the intensity-dependent effects. The hybridisation scatter plot and R-I plot with the values of Cy3-ureteric orifice and Cy5-dome show a very tight distribution pattern (Fig. 1a and b). The between-channels symmetry observed in both plots visually indicates the sufficiency of the applied normalisation method and ensured high quality and more balanced measures of differential-expression between the two bladder locations. This is indicated by the good balance correlation between the quantities of mRNA and the intensity in Cy3-Cy5 labelling.

Image

Fig. 1. (a) The R-I plot depict log2-transformed normalized differential-expression levels () as a function of . (b) Scatter plots for Cy3-ureteric orifice and Cy5-hybridisation. Plots show the variation in fluorescent signal intensities between the ureteric orifice and dome. The parallel lines flanking the centre diagonal line highlight changes in expression of 2-, 5-, and 10-fold.

Most points (Fig. 1a) are close to a differential expression value of 1 (ureteric orifice and dome show equal signal intensity) and are generally within the 1.5-fold range. A much smaller proportion of clones exhibits a ratio of Cy3:Cy5 of greater than 1.5-fold (Fig. 1b). In fact, when either a ratio of 2.0 or |Zi|≥1.96 was used as cut-off criteria there was a high similarity in expression and sensitivity with a very similar list of differentially expressed genes generated. The exception was only two genes different at the bottom end of the scored list. Therefore, the following criteria were used to define candidate genes that are differentially expressed between the ureteric orifice and the dome: (1) a ratio between Cy3 and Cy5 greater than 2.0; (2) signal intensity greater than 100; (3) signal to background ratio >2.5; and (4) signal size >40% of the spotting area. The application of these criteria revealed that 96.9% of the clones display a ureteric orifice to dome ratio, or dome to ureteric orifice ratio, of <2.0; the remaining clones show a ratio >2.0. Analysis of these genes revealed that 211 genes were upregulated and 101 downregulated (Table 2, Table 3, Table 4, Table 5). As seen in Table 4, most of the “increased” genes are involved in “metabolism” and “growth and development.” In contrast, most of the “decreased” genes are involved in “signal transduction” (Table 2).


Table 2.  Genes that are over- or underexpressed in the ureteric orifice compared to the dome that belong to the Function hierarchy of protein function
Gene name Expression/Signal Intensity Accession Number
1. Protein modification- maintenance
Heat shock protein 75 +2.1/++ U12595
Chaperonin containing TCP1, subunit 5 (epsilon) +2.4/++ D43950
Alpha-2-macroglobulin −2.1/N.I. NM_000014
Crystallin, alpha 13 −2.1/N.I AL038340
2. Membrane transport
Solute carrier family 25 (mitochondial carrier) +3.3/++ AW160902
Antigen identified by monoclonal antibodies 4F2, TROP.10, TROP4 and T43. +2.8/++ J02769
Kinectin gene AI950449
Solute carrier family 25 (mitochondial carrier) +2.6/++ AI860222
Solute carrier family 25 (mitochondial carrier) +2.0/++ J03592
Chloride intracellular channel 1 +2.6/++ AI357777
Proteolipid protein 2 (colonic epithelium-enriched) +2.0/++ U933305
Discs, large (drosophila) homolog 2 −2.0/N.I. U32376
Potassium inwardly-rectifying channel, subfamily J, member 1 −2.1/N.I. U03884
Solute carrier family 26 (sulfate transporter) member 2 −2.4/N.I. U14528
Potassium intermediate/small conductance calcium activated −2.2/N.I. AF022797
Sodium channel, voltage-gated, type IX, alpha poly-peptide −2.0/N.I. X82835
3. Localised and structural proteins
Keratin 7 +5.5/++ M13955
Antigen identified by monoclonal antibody Ki-67 +5.2/++ X65550
Interferon, alpha-inducible protein 27 +5.1/+++ AA302123
Keratin 7 +5.0/+++ AA307373
Flap structure specific-endonuclease 1 +4.8/+++ AW246270
Adaptor-related protein complex 2, sigma 1 subunit +3.5/+++ X97074
Interleukin 8 +3.3/++ M26383
Keratin 8 +2.6/++++ X74929
EGF – containing fibulin-like extracellular matrix protein 1 +2.6/++++ NM_004105
Follistatin-like 3 (secreted glycoprotein) +2.5/++ NM_005860
Centromere protein F (350/400kD, mitosin) +2.5/++ NM_005196
Interferon induced transmembrane protein 1 +2.3/++ J04164
Synaptogyrin 2 +2.1/++ NM_004710
Farnesyl-diphosphate farebesyltransferase 1 +2.1/+++ X69141
Defender against death +2.0/++ U84214
Interferon induced transmembrane protein 3 +2.0/++ X57352
Glucose regulated protein +2.0/++++ U42068
Laminin receptor 1 +2.0/++++ AW163837
Ribosomal protein S10 +2.0/+++ AW248883
Tubulin, beta, 5 +2.1/+++ AW160927
Ribosomal protein, large, PO +2.0/++ AW246110
RAD51 (S. cerevisiae) homolog (E. coli RecA homolog) +2.1/++ D14134
4. Signal transduction & regulation
Forkhead box M1 +5.2/++ U74612
Secretogranin II (Chromogranin C) +4.2/+++ M25756
Interleukin 8 +3.3/++ M26383
SHC (Src homology 2 domain-containing) transforming protein +3.3/++ X68148
V-myb avian myeloblastosis viral oncogene homologue-like 2 +3.1/++++ NM_002466
GRO1 oncogene (melanoma growth stimulating activity, alpha) +2.4/++ NM_001511
LIM and SH3 protein 1 +2.4/++ AA903810
Hepatoma-derived growth factor (high-mobility group protein 1-like) +2.3/++++ AI720570
Adenosine A2b receptor +2.3/++ X68487
Karyopherin alpha 2 (RAG cohort) +2.2/++ NM_002266
Cyclin A1 +2.2/++ U97680
v-Ha-ras Harvey rat sarcoma viral oncogene homolog +2.2/+++ AA479423
Paired box gene 8 +2.1/++ NM_003466
Cyclin D1 (PRAD1: parathyroid adenomatosis 1) +2.1/++ M73554
E2F transcription factor 1 +2.0/N.I. U47677
Interleukin enhancer binding factor 2 +2.0/++ AI348466
Lymphocyte antigen 6 complex, locus E +2.0/++ NM_002346
Opiate receptor-like 1 −2.0/N.I. U30185
Glioma-associated oncogene homolog −2.0/N.I. X07384
GDNF family receptor alpha 1 −2.0/N.I. NM_005264
Regulator of G-protein signalling 1 −2.0/N.I. S59049
Fibroblast growth factor 7 −2.0/N.I. AI075338
Glutamate receptor, metabotropic 3 −2.0/N.I. X77748
Pleiomorphic adenoma gene 1 −2.0/N.I. NM_002655
Collagen type XI alpha 1 2.0/N.I. R93890
A kinase (PRKA) anchor protein 9 −2.0/N.I. NM-005751
Guanine nucleotide binding protein (G protein) alpha activated homolog −2.0/N.I. U55184
Extracellular matrix protein 2 −2.0/+ AB011792
MAX dimerization protein −2.1/N.I. NM_002357
Interleukin 6 signal transducer −2.1/N.I. NM_002184
v-jun avian sarcoma virus 17 oncogene homolog −2.1/N.I. AI078377
Selectin L −2.1/N.I. X17519
GTP-binding overexpressed in sketetal muscle −2.1/++ AW297828
Neurophilin 2 −2.1/N.I. AF022859
Lymphoid nuclear protein related to AF4 −2.1/N.I. U34360
Gamma-aminobutryic acid (GABA) A receptor, beta 3 −2.1/N.I. M82919
POU domain, class 4, transcription factor 2 −2.1/N.I. U06233
Interleukin 8 receptor, alpha −2.2/N.I. M26383
Microphthalmia-associated transcritption factor −2.2/N.I. AI446072
Nuclear receptor subfamily 4, group A, member 1 −2.3/N.I. NM_002135
Calsequestrin 2, cardiac muscle −2.3/N.I. D31716
Rho-associated, coiled-coil containing protein kinase 1 −2.3/N.I. U43195
A kinase (PRKA) anchor protein 9 −2.3/+ NM_005751
Early growth response 1 −2.3/+ AA403009
Regulator of G-protein signalling 5 −2.4/N.I. AI674877
Basic transcription element binding protein 1 −2.5/++ D31716
Leukemia inhibitory factor receptor −2.6/N.I. NM_002310
v-maf musculoaponeurotic fibrosarcoma −2.6/N.I. AF055376
Early growth response 3 −2.6/N.I. X63741
Tranforming growth factor, beta receptor III (betaglygcan) −2.9/N.I. NM_003243
FBJ murine osteosarcoma viral oncogene homolog B −2.9/N.I. NM_006732
Transforming growth factor, beta receptor III −2.9/N.I. NM_003243
v-fos FBJ murine osteosarcoma viral oncogne homolog −3.2/N.I. AW073373
5. Adhesion & Molecular recognition
Lectin, galactoside-binding, soluble, 1 (galectin 1) +4.5/++++ AA035793
Integrin beta 4 binding protein +3.6/+++ Y11435
Apoptosis inhibitor 4 (survivin) +3.2/++ U75285
Fibronectin 1 +2.8/+++ X02761
Muf1 protein +2.3/++ AW249532
Integrin, alpha 3 +2.1/++ D01038
Immunoglobulins heavy constant gamma 3 +2.0/++ D78345
Cadherin 11 −2.0/N.I. NM_001797
Syndecan 2 (heparan sulfate proteoglycan 1) −2.0/N.I. AI017925
Integrin, alpha 8 −2.3/++ L36531
Integrin, alpha 9 −2.4N.I. D25303
Integrin, alpha 1 −2.6N.I. X68742
Contactin 1 −3.6/++ AW262854

Table 3.  Genes that are over- or underexpressed in the ureteric orifice compared to the dome that belong to the Enzyme hierarchy of protein function
Gene name Expression/Signal intensity Accession number
1. Transferases
Thymidine kinase 1, soluble +6.0/++ NM_003258
Salivary proline rich protein +4.4/++
Non-metastatic cells 1, protein (NM23A) +3.7/++ AA788963
RAB6 ineracting, kinesin-like (rabkin-like (rabkinesin6) +3.6/N.I. NM_005733
Neurotrophic tyrosine kinase, receptor, type 1 +3.1/++ AW245470
Transglutaminase 2 +2.8/++ M98479
PCTAIRE protein kinase 1 +2.4/++ X66363
Pyridoxal (Pyridoxine, vitamin B6) kinase +2.2/++ NM_003681
Glutamic-oxaloacetic transaminase 2, mitochrondrial (aspartate aminotransferase 2) +2.2/+++ NM_002080
N-myristoyltransferase 1 +2.1/+++ M86707
Serine hydroxymethyltransferase 2 (mitochondrial) +2.1/+++ NM_005412
Protein kinase, DNA activated, catalytic polypeptide +2.0/++ NM_006904
Transforming growth factor, beta receptor II (70-80kDa) −2.0/N.I. NM_003242
Coagulation factor XIII, A1 polypeptide −2.0/N.I. M14539
Rho-associated, coiled-coil containing protein kinase 2 −2.1/N.I. NM_004850
Rho-associated, coiled-coil containing protein kinase 1 −2.3/N.I. U43195
Mycosin, light polypeptide, kinase −2.4/N.I. AF069601
Protein kinase, cGMP-dependent, type 1 −2.4/N.I. Z92867
Mycosin heavy polypeptide 11 smooth muscle −2.5/N.I. AB020673
Platelet-derived growth factor receptor, alpha polypeptide −2.7/N.I. AI672567
Phosphoinositide-3-kinase, class 3 −3.0/++ Z46983
2. Oxidoreductase
Lactate dehydrogenase A +4.0/+++ X02152
Steroyl-CoA desaturase (delta-9-desaturase) +2.6/++ AA357347
Cytochrome b-245, alpha polypeptide +2.4/++ NM_000101
Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2 +2.4/++ U54573
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide +2.3/+++ NM_003403
Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide +2.2/+++ U54778
Mannosidase, alpha, class 1B, member 1 +2.2/+++ NM_007230
Alcohol dehydrogenase 3 (class1), gamma, polypeptide) −2.2/N.I. NM_000669
Prostaglandin-endoperoxide synthase 2 −2.2/N.I. D28235
Phenylalanine hydroxylase −2.3/N.I. L47726
3. Hydrolases
Ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase +3.5/++ AI928978
4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1 +2.5/++ AJ001258
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 +2.5/++ AI88980
B-factor, properdin +2.2/++ X72875
N-methylpurine-DNA glycosylase +2.0/+ Z69720
Familial interhepatic cholesasis 1 −2.0/N.I. AF038007
A disintegrin and metalloproteinase domain II −2.1/N.I. AB009675
Dual specificity phosphatase 2 −2.1/N.I. NM_004418
Regulator of G-protein signalling 2 −2.1/N.I. AI802267
Mannosidase, alpha, class 1A, member 1 −2.1/N.I. AI743260
Butyrycholinesterase −2.1/N.I. M32391
Lipoprotein lipase −2.5/N.I. NM_000237
Phosphatidic acid phosphatase type 2b −2.7/N.I. AB000889
Phospholipase A2, group IIA −2.7/N.I. M22430
Mannosidase, alpha, class 1A, member 1 −3.0/++ AI743260
4. Ligases
Ubiquitin carrier protein +3.1/N.I. AI571293
MYC promoter-binding protein 1 +2.7/++++ AF035286
ATP citrate lyase +2.1/++ X64330
Guanylate cyclase 1, soluble, alpha 3 −2.0/N.I. U58855
5. Isomerases
Triosephosphate isomerase 1 +2.9/+++ U47924
FK506-BINDING PROTEIN 1A (12kD) +2.3/+++ M34539
Peptidylprolyl isomerase A +2.3/+++ AW245193
Peptidylprolyl isomerase B +2.2/+++ AW060876
Mevalonate decarboxylase +2.2/++ U49260
Protein disulfide isomerase related protein +2.2/++ NM_006810
FK506-BINDING PROTEIN 5 −2.3/N.I. U71321

Table 4. Genes that are over-or underexpressed in the ureteric orifice compared to the dome that belong to the Pathway hierarchy of protein function
 
Gene name Expression/Signal intensity Accession number
1. Metabolism
Aldo-keto reductase family 1, member B1 +6.8/++++ J05474
Pyruvate kinase, muscle +6.0/+++ AW007619
Serine/threonine kinase +4.7/++ NM_003600
Annexin A2 +4.6/++++ W53011
Stanniocalcin 2 +3.9/+++ AF098462
Minichromosome maintenance deficient +3.9/+++ AW264268
Glucoase-6-phosphate dehydrogenase +3.9/+ X55448
Transkeltolase (Weinicke-Korsakoff syndrome) +3.7/++ AI378884
Minichromosome maintenance deficient (S. cerevisiae) 7 +3.4/+++ D55716
Methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase +3.4/+ NM_006636
Minichromosome maintenance +3.4/++ AW264268
Tryptophanyl-tRNA synthetase +3.3/+ X59892
Stress-induced-phosphoprotein 1 +3.2/++ M86752
Small nuclear ribonucleoprotein polypeptides B and B1 +3.0/++ AI929102
Tyrosyl-tRNA synthetase +3.0/+ U89436
Triosephosphate isomerase 1 +2.9/++ U47924
Ferratin +2.9/++++ AW575826
Methionine-tRNA synthetase +2.9/+ AW410461
Enolase 3(beta, muscle) +2.9/+ X51957
Ribonucleotide reductase M1 polypeptide +2.8/+ NM_001033
Plasminogen activator +2.8/+ M14083
Phosphoglycerate mutase 1 (brain) +2.8/+ J04173
Serine/threonine kinase +2.7/++ NM_004217
Serum-inducible kinase +2.6/++ NM_006622
U5 snRNP-specific protein +2.6/++ D21163
Proteasome +2.6/+ LO2426
Ribosomal protein L35 +2.6/+++ AI815956
Pyrroline-5-carboxylate reductase 1 +2.6/N.I. M77836
L1 cell adhesion molecule +2.6/N.I. Z29373
Ribosomal protein L35 +2.6/+++ AI815956
S-adenosylhomocysteine hydrolase +2.6/+ M61831
Enolase 2 (gamma) +2.5/+++ NM_001975
Splicing factor 3b, subunit 3 +2.5/+ D87686
Structure specific recognition protein 1 +2.5/++ M86737
Threonyl-tRNA synthetase +2.5/+ NM_003191
Phosphofructokinase, platelet +2.5+ D25328
Cysteine-rich protein +2.4/+ J02356
Protein phosphatase 1G, magnesium dependent +2.4/++ Y13936
Proteasome (prosome) +2.4/+ AI831414
ATP synthase H+ transporting mitochonrial F!F0, subunit G +2.4/+ AI38629
Tyrosine 3 monooxygenase/Tryptophan +2.3/+ NM_003404
AXL receptor tyrosine kinase +2.3/+ X66029
Plasminogen activator inhibitor typeE 11 +2.2/N.I. J02685
Methylenetetrahydrofolate dehydrogenase +2.2/+ J04031
Deiodinase, iodothyronine, type 11 +2.2/N.I. AF007144
NADH dehydrogenase +2.2/+ AW084002
Plasminogen activator +2.2/++ D11143
Ribosomal protein S3 +2.2/++++ AA593872
Polymerase (RNA) II +2.2/++++ F24474
SWI/SNF related, matrix associated actin dependent regulator +2.2/++ AJ011737
Phosphoglycerate kinase +2.2/+++ M11968
Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) +2.1/+ AA310524
RNA helicase-related protein +2.1/+ AW192642
Glutathione-S-transferase like +2.1/+ AI752707
Proteasome (prosome) +2.1/+ AW405598
Transaldolase 1 +2.1/+ AA225054
Protease, serine 1, (trypsin 1) +2.0/++ NM_002769
Proteasome (prosome, macropain) 26 subunit +2.5/++ AI188980
ATP-binding cassette, subfamily B (MDR) +2.0/++ NM_000443
NADH dehydrogenase +2.0/N.I. AF038406
Lung resistance-related protein +2.0/++ X79882
Splicing factor, arginine/serine-rich 9 +2.0/+ NM_003769
Ribosomal protein S10 +2.0/++ AW248883
Replication protein A2 +2.0/+ J05249
Replication protein A3 +2.0/N.I. NM_001033
Nulcear RNA helicase +2.0/+ AW248283
Calpain, small polypeptide +2.0/+++ NM_001749
Proteasome +2.0/+ AI923532
Interleukin enhancer binding factor 2 +2.0/++ AL040836
Deoxythymidylate kinase +2.0/N.I. L16991
Transcription elongation factor B (SIII) polypeptide 2 +2.0/+ AI344424
Sjogren syndrome antigen A1 (52kD, ribonucleoprotein anti-antigen SS-A/Ro) +2.0/++ M62800
Splicing factor 3b, subunit 2 +2.0/++ NM_006842
STAT induced STAT inhibitor 3 −2.5/N.I. AF06321
2. Growth & Development
Cell division cycle 20, S cerevisiae homolog +5.1/++++ AW411344
Cell division cycle 25B +4.8/+++ M81934
Insulin-like growth factor binding protein +4.3/+++ M62403
Asparagine synthetase +3.7/++ AC005326
Budding uninhibited by benzimidazoles 1 (yeast homolog), beta +3.7/++ AF053306
Midkine (neurite growth-promoting factor 2) +3.6/++ AA605069
SHC (Src homology 2 domian-containing) transforming protein +3.3/++ X68148
Apoptosis inhibitor 4 (survivin) +3.2/++ U75285
Immediate early response 3 +2.9/++ AA403009
BCL2-like 1 +2.7/++++ Z23115
Cysteine-rich protein 1 (intestinal) +2.4/++ AI208340
Kinesin-like 4 +2.4/++ AB017430
Mal, T-cell differentiation protein +2.2/+++ M15800
Proliferation-asociated gene A (natural killer-enhancing factor A) +2.2/+++ AW409672
TNF receptor-associated factor 2 +2.1//N.I. U12597
Defender against cell death-1 +2.0/++ U84214
S100 calcium-binding protein +2.0/++ AA593632
ARP1 (actin-related protein, yeast homolog A) +2.0/++ X82206
Insulin-like growth factor binding protein 5 −2.0/N.I. AA374325
CUG triplet repeat, RNA binding protein 2 −2.0/N.I. AF036956
SH3-domain GRB2-like 3 −2.2/N.I. H20194
Latent transforming growth factor beta binding protein 4 −2.8/N.I. AF051344
3. Ecological interactions
Immunoglobulin kappa variable 1D-8 +2.2/++++ AW404507
Small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2) +2.1/N.I. NM_002993

Table 5.  Genes that are over- or underexpressed in the ureteric orifice compared to the dome that have yet to be assigned a function KIAA and ESTs genes
Gene name Expression/Signal intensity Accession number
Human mRNA for KIAA0018a +8.4/+++++ D13643
KIAA0101 gene product +3.8/++ NM_014736
KIAA0095 +3.2/++ XM_165647
KIAA0008 +3.1/++ BC016276
KIAA0161 +2.5/++ D79983
KIAA0111 +2.2/+++ D21853
KIAA0074 +2.0/ XM_049116
KIAA0088 +2.0 D42041
KIAA0022 −2.9/ D14664
KIAA0336 −2.4/ AB002334
KIAA0938 −2.1/ AB023155
KIAA0442 −2.1/ AB007902
ESTs Weakly similar to Yhr075cp +3.4 W40312
Human mRNA for the unknown product, partial sequence +2.9 D29810
ESTs Highly similar to CGI-141 protein +2.8 AA307912
ESTs Highly similar to SPLICING FACTOR UZAF 65kD SUBUNIT +2.5 AA505415
ESTs Highly similar to phosphoserine aminotransferase +2.4 AA587912
ESTs Weakly similar to alpha 1 +2.3 A1031800
ESTs PD 194162 +2.4 Incyte
ESTs PD 80187 +2.3 Incyte
ESTs Weakly similar to cDNA EST EMB: D36107 +2.1 AI970199
ESTs PD 2237234 +2.1 Incyte
ESTs PD 1930135 +2.0 Incyte
ESTs PD 757370 +2.0 Incyte
ESTs PD 1731790 −2.0 Incyte
ESTs PD 2189677 −2.0 Incyte
ESTs PD 1287278 −2.0 Incyte
ESTs PD 3606345 −2.1 Incyte
ESTs PD 3364304 −2.2 Incyte
ESTs PD 2806295 −2.2 Incyte
ESTs PD 1753033 −2.2 Incyte
ESTs PD 2955163 −2.3 Incyte
ESTs PD 262207 −2.3 Incyte
ESTs PD 1495766 −2.6 Incyte
ESTs PD 2753371 −2.6 Incyte
a Seladin-1 other aliases 24-dehydrocholesterol reductase, DHCR24.

3.2. RT-PCR analysis of differentially expressed genes

We selected five genes that were differentially expressed between the ureteric orifice and dome for RT-PCR analysis on the pooled sample to confirm the expression data from our microarray studies. Three of these genes—Cdc25B, TK1, and PKM—were elevated in cancer; PDGFra is often downregulated. In addition, Seladin-1 (aliases KIAA0018, 24-dehydrocholesterol reductase, DHCR24), the most highly upregulated gene on the array, was also selected even though it had no known function at the time of this study. Based on this information, we selected these genes for confirmation by RT-PCR. Consistent with the microarray data, Cdc25B, PKM, TK1, and Seladin-1 were all found to be elevated and PDGFra was confirmed to be downregulated in the ureteric orifice compared to the dome (Fig. 2). Therefore, the RT-PCR results obtained for these clones were comparable to the array result (Table 6) and confirmed the direction of fold change for all the samples where the microarray fold change was >2.0.

Image

Fig. 2.
A strong correlation between the levels of expression of five transcripts in the ureteric orifice versus the dome discovered by microarray analysis and confirmed by RT-PCR. Confirmation analysis by RT-PCR was carried out on five differentially expressed clones uncovered by microarray analysis. The results of RT-PCR were normalised to the expression of r28S or GAPDH in each sample, and expressed as fold change of the ureteric orifice over the expression of the dome.



Table 6.  List of genes selected for verification and the relative expression differences by microarray and RT-PCR
Accession no. Gene description Normalised relative expression levels
Microarray RT-PCR
NM_003258 Thymidine kinase 1 6.0 7.5
AW007619 Pyruvate kinase muscle 6.0 7.8
S78187 Cell cycle division 25 B 4.8 5.6
D13643 Seladin-1 8.4 11.8
NM_006206 Platelet-derived growth factor receptor −2.7 −2.5

4. Discussion

One of the major applications of microarray is comparative gene expression analysis of cells that have various types of biological behaviour. Studies that involve normal tissue are extremely rare because obtaining normal, well-preserved surgical samples is difficult. To our knowledge this is the first report to examine two normal anatomically distinct regions of the bladder. In this study we obtained small-paired samples of bladder from the ureteric orifice and dome of 33 male volunteers (see Methods section for selection criteria). Equal amounts of isolated RNA from each sample were pooled to obtain two samples (ureteric orifice and dome). The main advantages of this approach were that it obviated the need to amplify signal from minute samples, which could create bias in the samples and lead to inaccuracies in expression differences; and it gave a biological average by removing noise that was generated by the normal genetic variation of individuals and left the most affected genes increased or decreased in the two samples. A recent study suggests that pooling samples can, in a single assay, provide results that summarize the expression of individual samples, and that independently derived pools can provide nearly identical measures of gene expression [8]. The disadvantage of this approach is the loss of information on individuals; however, since we were interested in the principle of predisposing genes in a population rather than in a single patient, we felt this approach was justified.

This study provided a unique opportunity to make a comprehensive evaluation of the genetic background (10,176 genes) in these two areas that clearly illustrate differential sensitivity to carcinogenesis. Notably, 96.9% of all the genes on the array did not differ between the two regions of the bladder. Analysis revealed differential expression of 312 genes: 211 were upregulated in the ureteric orifice; 101 were downregulated. The genes were organised according to known cellular function and the main groups upregulated in the ureteric orifice were involved in “metabolism” and “growth and development.” This suggests that the ureteric orifice may have a faster turnover rate that may influence cancer predisposition by increasing the probability of mutations. Conversely, previous research that involves the bladder epithelium has reported a very low turnover rate [9], [10], which is consistent with the reported life span of normal urothelium of 200 days [11], [12]. However, these studies do not detail the precise region of the bladder that was examined, so any regional differences could have gone undetected.

Five of the transcripts that showed differential expression were selected for further evaluation: four upregulated genes, Cdc25B, TK1, PKM, Seladin-1, and one downregulated gene, PDGFra. All genes showed good correlation between the microarray result and the evaluation by PCR (Table 6). Oncomine analysis of expression data indicated that Cdc25B is elevated in primary bladder tumours compared to other tumour types (p=6.1E-4) [13]. Cdc25B is a rate-limiting component of mitosis, and its overexpression can result in cells bypassing the S-phase replication checkpoint and entering mitosis prematurely regardless of the state of their DNA [14]. Cdc25B was overexpressed in the ureteric orifice compared to the dome, and Cdc25B could be an early marker for predisposition to bladder carcinogenesis.

Human cytosolic TK1 is a salvage pathway enzyme for 2′-deoxythymidine 5′-triphosphate (dTTP) formation. Microarray analysis of TK1 levels indicated a sixfold increase in the ureteric orifice compared to the dome; RT-PCR confirmed this with a 7.5-fold elevation. Interestingly, analysis of microarray data with Oncomine revealed that TK1 is overexpressed in primary bladder tumours relative to other tumour types (p=0.003) [13]. Overexpression of TK1 promotes proliferation by providing dTTP for DNA replication and by attenuating the function of p21Waf1 in the presence of DNA damage [15].

Evidence suggests that some of the signals that link metabolism to cell proliferation may be provided by phosphometabolites [16], [17]. PKM, an isoform of pyruvate kinase [18], was upregulated in the ureteric orifice compared to the dome by sixfold. Shifts towards K-type isozyme, which reverses the development process, have been observed in neoplastic tissues such as brain tumour [19], breast cancer [20] and hepatoma [21]. The mechanism that causes the switch from the M-type to the K-type isoenzyme is currently unknown. PDGFraα is involved in migration, proliferation, cell contractile function, and alteration of cellular metabolic activities. PDGFra was downregulated in the ureteric orifice by 2.7-fold, and was confirmed by real time RT-PCR (2.5-fold). Oncomine analysis showed that PDGFra is decreased in tumours relative to normal bladder tissue (p=0.009) [22].

Cdc25B, TK1, PKM, and PDGFra have all been implicated in the pathogenesis of various cancers, unlike Seladin-1, whose role is yet to be defined. Seladin-1 was upregulated in the ureteric orifice samples on the array by 8.3-fold RT-PCR and 11.8-fold by RT-PCR. This gene was first discovered in patients with Alzheimer's disease, where decreased expression levels were associated with apoptosis and neuronal degeneration [23]. Its role in bladder epithelium is unknown. However, Seladin-1 maps to chromosome 1p33-p31.1 [23], [24], [25], a region that is noted for amplification in early stage bladder cancer [26]. Recent evidence suggests Seladin-1 is a regulator of cellular response to oncogenic and oxidative stress [23], and ablation of this gene in the presence of these stresses results in cellular transformation [27]. In contrast, elevated levels of Seladin-1 expression have been found in adenomas from patients who suffer from Cushing syndrome [28] as well as breast [29] and prostate [30] tumours. The significance of Seladin-1 upregulation in the ureteric orifice of the bladder is yet to be established; however, hypothesising that it may facilitate inhibition of apoptosis is tempting. This, coupled with the proposed increase in proliferation, could increase the probability of mutation and accumulation of aberrant cells.

Identification of the early molecular alterations that contribute to carcinogenesis is a major goal in cancer research. Although a number of genetic alterations have been reported in urological cancers, there is still a lack of knowledge as to the initial molecular changes [31], [32]. This study has provided the first evidence of differential gene expression in two normal areas of human bladder mucosa that exist in the same physiological environment yet illustrate differential sensitivity to carcinogenesis. Of particular note is Seladin-1, whose significance in cancer is yet to be clarified and whose expression was significantly higher in the area of the bladder that is more prone to tumour development. Recent literature has implicated altered Seladin-1 expression levels in carcinogenesis [28], [29], [30]. Further work that investigates the levels of Seladin-1 in primary tumours may also be informative. In addition to the limited number of genes discussed here, our analysis identified a number of poorly characterised ESTs that are likely to represent novel genes of unknown function, much like Seladin-1, which was novel at the time of this study. Additional study of these genes may provide new insights into bladder cancer biology as well as other epithelial cancers types.

Acknowledgments

The authors would like to gratefully acknowledge funding from the following sources. Vera Furness Fellowship Grant, Belfast City Hospital Urology Fund Grant, and a studentship from the Department of Employment and Learning, Northern Ireland awarded to S.C Doherty.

References

1. Spruck CH, Ohneseit PF, Gonzalez-Zulueta M, et al.. Two molecular pathways to transitional cell carcinoma of the bladder. Cancer Res. 1994;54:784–788.

2. Stinson SF, Alley MC, Kopp WC, et al.. Morphological and immunocytochemical characteristics of human tumor cell lines for use in a disease-oriented anticancer drug screen. Anticancer Res. 1992;12:1035–1053.

3. Junker K, Boerner D, Schulze W, Utting M, Schubert J, Werner W. Analysis of genetic alterations in normal bladder urothelium. Urology. 2003;62:1134–1138.

4. Melicow MM. Tumors of the bladder: a multifaceted problem. J Urol. 1974;112:467–478.

5. Page BH, Levison VB, Curwen MP. The site of recurrence of non-infiltrating bladder tumours. Br J Urol. 1978;50:237–242.

6. Hutch J. Anatomy and physiology of the bladder, trigone and urethra. Butterworth; 1972;.

7. Stewart LH, O’Neill KL, McKelvey VJ, et al.. Why do most primary bladder neoplasms first appear around the ureteric orifices?. Br J Urol. 1993;71:34–37.

8. Agrawal D, Chen T, Irby R, et al.. Osteopontin identified as lead marker of colon cancer progression, using pooled sample expression profiling. J Natl Cancer Inst. 2002;94:513–521.

9. Koss LG. A light and electron microscopic study of the effects of a single dose of cyclophosphamide on various organs in the rat. I. The urinary bladder. Lab Invest. 1967;16:44–65.

10. Baskin LS, Sutherland RS, Thomson AA, et al.. Growth factors in bladder wound healing. J Urol. 1997;157:2388–2395.

11. Cooper EH. The biology of bladder cancer. Ann R Coll Surg Engl. 1972;51:1–16.

12. Hainau B, Dombernowsky P. Histology and cell proliferation in human bladder tumors. An autoradiographic study. Cancer. 1974;33:115–126.

13. Dyrskjot L, Thykjaer T, Kruhoffer M, et al.. Identifying distinct classes of bladder carcinoma using microarrays. Nat Gen. 2003;33:90–96.

14. Karlsson C, Katich S, Hagting A, Hoffmann I, Pines J. Cdc25B, Cdc25C differ markedly in their properties as initiators of mitosis. J Cell Biol. 1999;146:573–584.

15. Huang DY, Chang ZF. Interaction of human thymidine kinase 1 with p21(Waf1). Biochem J. 2001;356:829–834.

16. Mazurek S, Boschek CB, Eigenbrodt E. The role of phosphometabolites in cell proliferation, energy metabolism, and tumor therapy. J Bioenerg Biomembr. 1997;29:315–330.

17. Kaplan O, Navon G, Lyon RC, Faustino PJ, Straka EJ, Cohen JS. Effects of 2-deoxyglucose on drug-sensitive and drug-resistant human breast cancer cells: toxicity and magnetic resonance spectroscopy studies of metabolism. Cancer Res. 1990;50:544–551.

18. Imamura K, Tanaka T. Pyruvate kinase isozymes from rat. Methods Enzymol. 1982;90 Pt E:150–165.

19. Van Veelen CW, Rijksen G, Van Ketel BA, Staal GE. The pyruvate kinase isoenzyme shift in human gliomas: a potential marker in the treatment of gliomas. Br J Neurosurg. 1988;2:257–263.

20. Lopez-Alarcon L, Ruiz P, Gosalvez M. Quantitative determination of the degree of differentiation of mammary tumors by pyruvate kinase kinetic analysis. Cancer Res. 1981;41:2019–2020.

21. Farina FA, Shatton JB, Morris HP, Weinhouse S. Isozymes of pyruvate kinase in liver and hepatomas of the rat. Cancer Res. 1974;34:1439–1446.

22. Ramaswamy S, Tamayo P, Rifkin R, et al.. Multiclass cancer diagnosis using tumour gene expression signatures. PNAS. 2001;98:15149–15154.

23. Greeve I, Hermans-Borgmeyer I, Brellinger C, et al.. The human DIMINUTO/DWARF1 homolog seladin-1 confers resistance to Alzheimer's disease-associated neurodegeneration and oxidative stress. J Neurosci. 2000;20:7345–7352.

24. Nomura N, Miyajima N, Sazuka T, et al.. Prediction of the coding sequences of unidentified human genes. I. The coding sequences of 40 new genes (KIAA0001-KIAA0040) deduced by analysis of randomly sampled cDNA clones from human immature myeloid cell line KG-1 (supplement). DNA Res. 1994;1:47–56.

25. Waterham HR, Koster J, Romeijn GJ, et al.. Mutations in the 3beta-hydroxysterol Delta24-reductase gene cause desmosterolosis, an autosomal recessive disorder of cholesterol biosynthesis. Am J Hum Genet. 2001;69:685–694.

26. Koo SH, Kwon KC, Ihm CH, Jeon YM, Park JW, Sul CK. Detection of genetic alterations in bladder tumors by comparative genomic hybridization and cytogenetic analysis. Cancer Genet and Cytogenetics. 1999;110:87–93.

27. Wu C, Miloslavskaya I, Demontis S, Maestro R, Galaktionov K. Regulation of cellular response to oncogenic and oxidative stress by Seladin-1. Nature. 2004;432:640–645.

28. Sarkar D, Imai T, Kambe F, et al.. The human homolog of Diminuto/Dwarf1 gene (hDiminuto): a novel ACTH-responsive gene overexpressed in benign cortisol-producing adrenocortical adenomas. J Clin Endocrinol Metab. 2001;86:5130–5137.

29. Nagai MA, Ros N, Bessa SA, Mourao NM, Miracca EC, Brentani MM. Differentially expressed genes and estrogen receptor status in breast cancer. Int J Oncol. 2003;23:1425–1430.

30. Nelson PS. Identifying immunotherapeutic targets for prostate carcinoma through the analysis of gene expression profiles. Ann N Y Acad Sci. 2002;975:232–246.

31. Porkka KP, Visakorpi T. Molecular mechanisms of prostate cancer. Eur Urol. 2004;45:683–691.

32. Kim WJ. Genetic and epigenetic aspects of bladder cancer. J Cell Biochem. 2005;95:24–33Review.

Sharon C. Dohertya, Stephanie R. McKeowna, Jesus A. Lopezb, Ian K. Walshc, Valerie J. McKelvey-Martina

a Cancer and Ageing Research Group, Biomedical Sciences Research Institute, University of Ulster, Coleraine, Northern Ireland, UK BT52 1SA
b Department of Mathematics and Computing, Faculty of Sciences, University of Southern Queensland, Toowoomba, Qld, 4350, Australia
c Regional Urology Service, Belfast City Hospital, Lisburn Road, Belfast, Northern Ireland, UK BT9 7AB

Accepted 10 January 2006 published online 25 January 2006.

Reader Comments

Please log-in or register in order to submit comments.

Powered by AkoComment!

 
Bookmark and Share
< Prev   Next >

Member's Section

Login

Sign Up

Quick Search